Molecular Detection and Typing

Gloria Sánchez, Cristina Villena, Albert Bosch, and Rosa M. Pintó

1. Introduction

Hepatitis A virus (HAV) infection is the leading cause of viral hepatitis throughout the world (1). HAV infection is mainly propagated via the fecal-oral route (2), and waterborne (3) and foodborne (4-8) outbreaks of the disease have been reported.

HAV, the prototype of the genus Hepatovirus, belongs to the family Picornaviridae. Its 7.5-kb single-stranded RNA genome bears different distinct regions: the 5' and 3' noncoding regions (NCR), the P1 region, which encodes the structural proteins VP1, VP2, VP3, and a putative VP4, and the P2 and P3 regions encoding nonstructural proteins associated with replication (9). A single HAV serotype has been described, although seven genotypes have been defined (9).

Since environmental samples usually contain low numbers of viral particles, sensitive methods such as molecular techniques based on nucleic acid amplification are required for their detection. However, even with the adoption of these techniques, the choice of the most adequate target is of relevant importance. The target region should be highly conserved, to increase the chance of detection, and should have an appropriate structure and length to allow sensitivity high enough for these kind of samples. As a target region, we have chosen a fragment of the 5'NCR flanked by highly conserved sequences that have been used for the primer design (forward primer from position 68 to position 85; reverse primer from position 222 to position 240 in the HM175 strain of HAV; GenBank accession number M14707) (4). The internal part of this region, however, may present a certain degree of variation mainly owing to insertions and/or deletions, causing a variable size of the amplimer obtained, i.e., the wild-type HM175 strain gives a size of 174 bp whereas the cell-adapted pHM175 strain gives a size of 186 bp. For this reason it is extremely important to include a confirmative method such as Southern blot hybridization with an internal probe from a region not affected by the insertions/deletions (4).

When genotyping is the objective of the study, analysis of the sequence corresponding to the VP1X2A junction is the method of choice (10,11), allowing HAV isolates to be differentiated into seven genotypes (10). It should be pointed out that although the sequence employed aligns with the VP1X2A junction region used for genotyping purposes in other picornaviruses, such as poliovirus (10), in the case of HAV (position 3024-3191 of the HM175 strain) it actually represents a 2A sequence, since it contains only 1 codon of VP1 and 55 of 2A (12,13). This method consists of the amplification of a 360-bp fragment (from position 2949 to position 3308) that includes the previously mentioned genotyping region. The size of the amplimer (360 bp) induces a loss of detection sensitivity, which is partially overcome by the application of nested polymerase chain reaction (PCR) procedures. However, the use of nested PCR techniques may introduce important cross-contamination problems since the first amplimer product should be further manipulated into a second reaction. Consequently, there is a growing tendency to avoid nested reactions as much as possible in diagnostic laboratories. This is the reason why we have adopted amplification of a shorter fragment of the 5'NCR for the generic detection of HAV. HAV genotyping is subsequently performed on those samples that are clearly positive, by the 5'NCR method, in a single PCR reaction using the previously mentioned 360-bp fragment.

All nucleic acid polymerasing reactions are susceptible to inhibitors, and reverse transcriptase (RT) is especially sensitive to inhibitory substances, which may be found in water samples. In environmental studies, a water concentration step is frequently required to reduce the sampled volume to an amount able to be analyzed in the laboratory. Unfortunately, substances inhibitory to RT-PCR are concentrated along with the viruses. Preconditioning of the sample should then be performed prior to the molecular amplification. In the present work, the method of choice for this purpose has been lyophilization, which efficiently removes several volatile inhibitors and at the same time allows viral concentration (14).

2. Materials

2.1. Sample Preconditioning

1. Plastic containers.

2. Autoclaved (121°C for 45 min) molecular biology grade distilled water (conductance 2 x 10-6 ohm-1 cm-1; Panreac, Barcelona, Spain; see Notes 1 and 2).

3. Freeze Drying Bench Top 3 from Virtis (Gardiner, NY) or similar.

2.2. RNA Extraction (see Note 3)

1. Washing buffer (L2): add 120 g of guanidinium isothiocyanate (Applichem, Darmstadt, Germany) to 100 mL of 0.1 M Tris-HCl, pH 6.4. Heat at 56°C to dissolve. Store in aliquots in the dark at room temperature. This solution is stable for 3 wk.

2. Lysis buffer (L6): add to 200 mL of L2 washing buffer 22 mL of 0.2 M EDTA, pH 8.0, and 2.44 mL Triton X-100. Store in aliquots in the dark at room temperature. This solution is stable for 3 wk.

3. Silica solution:

a. Add 60 g of silicon dioxide (Sigma, St. Louis, MO) to 500 mL of autoclaved (121°C for 45 min) distilled H2O in a 500 mL RNase-free bottle and keep it for 24 h at room temperature.

b. Aspirate 430 mL of the supernatant and resuspend the pellet in 500 mL of autoclaved (121°C for 45 min) distilled H2O.

c. Allow to stand for 5 h at room temperature and aspirate 450 mL of the supernatant.

d. Add 600 ^L of 8.7 M HCl to this supernatant and distribute it in aliquots of 0.5 mL before autoclaving at 121°C for 20 min.

e. Store in the dark at room temperature.

f. This solution is stable for 6 mo.

6. TE buffer, pH 8: 10 mM Tris-HCl and 1 mM EDTA. Adjust the pH to 8.0. Aliquots are distributed in 1.5-mL tubes and autoclaved at 121°C for 45 min.

7. Vortex.

8. Microcentrifuge.

9. Heating block.

10. 1.5-mL Microcentrifuge tubes.

11. Tips with filter.

12. Gloves.

1. Murine Moloney leukemia virus (M-MLV) reverse transcriptase RNase H Minus (Promega, Madison, WI) supplied with 5X RT buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2, 50 mM dithiothreitol).

2. Deoxynucleotide triphosphates (dNTPs) (Promega).

3. Reverse primers (HAV240: 5'-241GGAGAGCCCTGGAAGAAAGA222-3' and VP1-3285: 5'-3285AGTCACACCTCTCCAGGAAAACTT3308-3').

4. Autoclaved (121°C for 45 min) distilled H2O.

5. Thermocycler AB 2700 (Applied Biosystems, Foster City, CA) or similar.

6. Micropipets and filter tips.

1. Expand High Fidelity PCR enzyme (Roche, Mannheim, Germany) supplied with 10X Expand High Fidelity buffer and supplemented with 15 mM MgCl2.

2. Deoxynucleotide triphosphates (dNTPs).

3. Reverse (HAV240: 5'-241GGAGAGCCCTGGAAGAAAGA222-3' and VP1-3285: 5'-3285AGTCACACCTCTCCAGGAAAACTT3308-3') and forward (HAV68: 5'-68TCACCGCCGTTTGCCTAG85-3' and VP1-2949: 5'-2949TATTTGTCTGTCA CAGAACAATCAG2973-3') primers.

4. Autoclaved (121°C for 45 min) distilled H2O.

5. Thermocycler AB 2700 or similar.

6. Micropipets and filter tips.

2.5. Electrophoresis

1. 10X TBE buffer: 0.9 M Tris-HCl, pH 8.3, 0.9 M boric acid, 0.02 M EDTA. Stable for long periods.

2. 10X TAE buffer: 0.4 M Tris-HCl, pH 8.3, 0.11 M acetic acid, 0.01M EDTA. Stable for long periods.

3. Seakem LE agarose (BioWhittaker, Walkersville, MD).

4. GelStar Nucleic Acid Gel Stain (BioWhittaker).

5. 6X loading buffer: 50% (v/v) glycerol, 0.25% (w/v) bromophenol blue (Sigma) in distilled water. Store at 4°C. Stable for long periods.

6. Prepare a working solution of the DNA molecular weight marker IX (72-1353 bp) (Roche) by mixing 10 ^L of marker with 73.40 ^L of TBE or TAE, and 16.6 ^L of 6X loading buffer.

7. Horizontal gel tank, gel mold, gel combs (Bio-Rad, Hercules, CA) and power pack (Amersham Pharmacia Biotech Europe, Freiburg, Germany), or similar.

8. ImageMaster VDS gel imaging system analyzer (broad band UV 260-400 nm, peak at 312 nm; Amersham Pharmacia Biotech Europe) or similar.

2.6. Southern Blot

1. Positively charged nylon membrane (Roche).

2. Whatman 3MM paper.

3. Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad) or similar.

4. TBE buffer.

5. 150 mM NaOH. Stable for long periods.

6. 20% sodium dodecyl sulfate (SDS). Stable for long periods.

7. 20X SSC buffer: 3 M NaCl, 300 mM sodium citrate, pH 7.0. Autoclave at 121°C for 20 min (see Note 5). Stable for long periods.

8. Digoxigenin (DIG)-labeled probe (5'-150TTAATTCCTGCAGGTTCAGG169-3').

9. Standard solution: 5X SSC buffer supplemented with 0.1% N-lauroylsarcosine, 0.02% SDS, and 1% blocking reagent (Roche). Heat to 60°C to dissolve the detergents and the blocking reagent. Dispense in 10-mL aliquots and store at -20°C.

10. Prehybridization solution: standard solution supplemented with 100 ^g/mL salmon sperm DNA. To denature the salmon DNA, boil a 100X solution before being added to the standard solution (see Note 6).

11. Hybridization solution: DIG-labeled probe diluted in prehybridization solution.

12. Buffer I: 100 mM maleic acid, 150 mM NaCl, pH 7.5 (see Note 7). Autoclave at 121°C for 20 min. Stable for long periods.

13. Blocking solution: add 1 g of blocking reagent to 100 mL of buffer I. Autoclave at 121 °C for 20 min, store at 4°C, and open it carefully in sterile conditions. Stable for 2 mo.

14. Anti-DIG alkaline phosphatase-labeled antibody (anti-DIG-AP) (0.75 U/^L; Roche).

15. Washing buffer: add 0.3 mL of Tween-20 to 100 mL of buffer I. Store at 4°C. Stable for long periods.

16. Phosphatase buffer: 100 mM Tris-HCl and 100 mM NaCl, pH 9.5. Store at 4°C. Stable for long periods.

17. 25 mM CSPD solution (Roche). Store in the dark.

18. Fixative solution: dilute 1:5 the fixative G350 (AGFA-Gevaert, Mortsel, Belgium). Store in the dark. Stable for several months.

19. Developer solution: dilute 1:5 the developer G150 (AGFA). Store in the dark. Stable for several months.

20. Film: AGFA curix RP2 100NIF 13 x 18.

21. Autoradiographic cassette (Gevamatic AGFA 18 x 24).

22. Plastic bags.

23. Trays.

24. Forceps.

25. Aluminum paper.

26. Plastic bag sealer.

28. Water bath: Certomat (22-100 ± 0.5°C; Braun Biotech, Melsungen, Germany) or similar.

29. Vacuum oven.

30. Belly Dancer.

31. Dark room.

Was this article helpful?

0 0

Post a comment