PRINS Reaction

2.2.1. Equipment

1. Glass slides (25 x 75 x 1 mm; VWR Scientific, Inc.) and selected micro cover glasses, cover slips (24 x 30 mm) (VWR Scientific, Inc.). The slides must be cleaned by soaking in series of ethanol solutions followed by polishing with a clean piece of muslin and wiped dry using lint-free paper before dropping the cells on the slides.

2. Variable volume micropipets ranging from 0 pL to 1000 pL.

3. Microcentrifuge tubes (1.5 mL).

4. Plastic and glass Coplin jars, or other suitable containers for washing the slides.

5. 50-mL Centrifuge tube.

6. 15-mL Polypropylene conical tube 17 x 120-mm style (Becton Dickinson).

7. Forceps.

8. Humidified slide chamber.

9. Water bath with accurate temperature control at 37°C.

10. Centrifuge (ICE centrifuge).

11. Thermotron environmental control unit (CDS-5, Thermotron)

13. Light microscope.

14. Thermal cycling machine equipped with a flat block thermal cycler PTC (Program Temperature Control).

2.2.2. Solutions

1. 20X Standard saline citrate (SSC): 3.0 MNaCl, 0.30 Mtri-sodium citrate, pH 7.2-7.4.

2. 2X SSC, pH 7.2-7.4 (diluted from stock 20X SSC): Store these solutions at ambient temperature and discard after 6 mo or sooner if the solution appears cloudy or contaminated.

4. 10X Phosphate-buffered saline (PBS): 1360 mM NaCl, 20 mM KCl, 106 mM Na2HPO4, 15 mMKH2PO4, pH 7.2-7.4.

5. 1X PBS, pH 7.2-7.4 (diluted from stock 10X PBS): Store PBS solutions at ambient temperature and discard after 6 mo or sooner if the solution appears cloudy or contaminated.

6. Tris-EDTA (TE) buffer: 10 mM Tris-HCl, pH 8.0; 1 mMEDTA.

7. Denaturation solution: 70% formamide/2X SSC. Prepare denaturation solution by mixing thoroughly 35 mL of deionized formamide (ultrapure grade, Fluka), 5 mL of 20X SSC, and 10 mL of distilled water in a glass Coplin jar, pH 7.2-7.4. Between usage, store denaturation solution at 2-8°C and discard after 3 to 5 d.

8. Washing buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100 or 0.2% Tween-20.

9. Blocking buffer: 5% dried skimmed milk powder in wash buffer. Centrifuge for 2 min and use the supernatant, which can be stored at 4°C for up to 3 d.

10. PRINS reaction solution: For each slide, in a 1.5-mL microtube, mix: 5 |L of 10X polymerase chain reaction buffer (Roche Molecular Biochemicals), dATP, dCTP), d-GTP, and dTTP working solution (4 |L of each), primer solution (2 |L), 1 mMbiotin-dUTP (1 |L) or 1 mMdigoxigenin-dUTP (1 |L), 2.5 |L of glycerol (see Note 1), 23 |L of distilled water, and 0.5 |L of Taq DNA polymerase (Roche Molecular Biochemicals; add immediately before starting the PRINS reaction).

1. Resuspend the oligonucleotides in TE buffer for a concentration of 100 |M as a primer stock solution (see Note 2).

2. Mix 5 |L of primer stock solution with 95 |L of TE buffer or water for a 5 |M primer working solution.

1. dCTP, dGTP, and dATP working solution: Dilute 100 mM stock solution of each of dNTP (Roche Molecular Biochemicals) to a concentration of 2.5 mMby mixing 1 |L of each dNTP with 39 |L of sterile distilled water.

2. dTTP working solution: Dilute 100 mM stock solution dTTP (Roche Molecular Biochemicals) to a concentration of 0.25 mM by mixing 1 |L of dTTP with 399 |L of sterile distilled water.

3. 1 mM of biotin-16-dUTP or biotin-11-dUTP (Enzo), and digoxigenin-11-dUTP (Roche Molecular Biochemicals).

2.3. Detection

1. 1% Avidin-fluorescein DCS (Vector Laboratories, Burlingame, CA) and 1% anti-dig-rhodamine (Roche Molecular Biochemicals; diluted with blocking buffer).

2. 1% Avidin-rhodamine (Roche Molecular Biochemicals) and 1% antidigoxigenin-fluorescein (Roche Molecular Biochemicals; diluted with blocking buffer). Either of the two aforementioned detection mixes can be used according to the selected labeling protocol for chromosome targets detection (see Note 3).

3. Counterstaining: In 1 mL of 0.1 MTris-HCl, pH 7, dissolve 125 ng of DAPI; (Sigma), 1 mg of p-phenylenediamine, and then mix with 9 mL of glycerol.

4. Fluorescence microscope equipped with appropriate and optimal filter sets (DAPI/Green dual bandpass, DAPI/Orange dual bandpass) and connected to an image system (e.g., ISIS 2 in MetaSystems, Belmont, MA).

3. Methods

3.1. Preparation of Fetal Cells

1. Before amniocentesis, the maternal blood samples were obtained by antecubital venepuncture in a VACUTAINER sodium heparin tube (Becton Dickinson).

2. Add 3 mL of sodium chloride, 0.9% solution, into a VACUTAINER K2 EDTA 3.6-mg lavender-top tube.

Table 1

Sequences of Oligonucleotide Primers Used in Dual-PRINS Technique

Table 1

Sequences of Oligonucleotide Primers Used in Dual-PRINS Technique

Annealing

Name

Location

Sequence

temperature

Ref.

Xc

X

GTTCAGCTCTGTGAGTGAAA

65°C

9

D599 (27-mer)

DYZ1

TGGGCTGGAATGGAAAGGAATCGAAAC

56°C

10

D600 (27-mer)

DYZ1 (pair for D599)

TCCATTCGATTCCATTTTTTTCGAGAA

56°C

10

3. Immediately after blood sampling (see Note 4), mix 3 mL of whole blood with 3 mL of sodium chloride, 0.9% solution, taken from VACUTAINER K2 EDTA tube and quickly aliquote six equal 1-mL volumes of into 6 Falcon polypropylene plain tubes (15 mL).

4. To wash the cells, 11 mL of Hank's Balanced Salt Solution (HBSS) is added to each 15-mL tube. This step is repeated twice.

5. After mixing, the cells are centrifuged at 500g for 7 min.

6. The platelet-rich supernatant is discarded, and the cells are resuspended in a hypotonic solution (0.075 M KCl) and incubated at 37°C for 10 to 15 min.

7. The cells are then centrifuged for 5 min at 667g.

8. Two Carnoy's fixations are performed using the standard methodology. The pellet is resuspended in 1 mL of fresh Carnoy.

9. Cell suspensions may be pooled in three microtubes (the volume equivalence of blood per microtube is 1 mL) and stored in Carnoy at -20°C for several months.

10. Spread 15 pL of fixed nucleus suspension onto cleaned slides in a modified Thermotron environmental control unit at an optimal temperature (25°C) and humidity (36% [8]). After that, immerse and agitate the slides in methacarn solution for 20 to 30 s (see Note 5). Then, put the slides on racks and keep them within Thermotron chamber until they dried. They can be used immediately or stored at -20°C for several weeks (see Note 6).

11. Denature slides in 70% formamide/2X SSC at 70°C for 2 min and successively pass them through 70%, 80%, and 100% ethanol for 2 min each at -20°C. After air-drying, the slides are ready for the PRINS procedure.

3.2. PRINS Reaction

1. Start the PRINS by adding the first reaction solution (50 pL) containing a specific X-chromosome primer and one of the labels onto a slide (see Note 3). Cover the slide with a cover slip and place the slide onto the flat block of a thermocycler.

2. Perform the annealing and extension steps according to the different primers used for the detection of different chromosome targets (see Note 2).

3. Wash the slide briefly in 1X PBS solution for 2 min after the first PRINS reaction ending.

4. Add the second reaction solution containing the Y specific primers for the chromosome Y and an alternately labeled dUTP on the same slide (see Note 7).

5. Perform the second PRINS reaction as in step 2 (see Note 8).

6. Wash the slide in wash buffer for 5 min with gentle agitation.

3.3. Detection

1. Mount the slide with 100 pL of blocking buffer and a cover slip. Leave the slide at room temperature for 5 min.

2. Remove the cover slip, drain blocking buffer from the slide, and apply 100 pL of a mix of detection solution to the slide.

3. Apply 100 pL of a detection solution mix (1% avidin-fluorescein and 1% antidig-rhodamine diluted with blocking buffer or 1% Avidin-rhodamine and 1%

Fig. 1. Dual-color PRINS labeling on chromosome-X (red signal) and Y (green signal) of a fetal nucleus from maternal blood from a woman carrying a male fetus. The white arrow indicates a male fetal cell surrounded by female maternal nuclei. (Please see color insert following p. 48.)

Antidigoxigenin-fluorescein diluted with blocking buffer). Either of the two aforementioned detection mixes can be used according to the selected labeling protocol for the detection of the two chromosome targets.

4. Place on a new cover slip and incubate the slide in a moist chamber at 37°C for 30 min.

5. Remove cover slips gently by tilting the glass slide, and let the cover slip slide off.

6. Wash the slide three times in wash buffer at room temperature for 5 min each with gentle agitation. Like that, excess antibody is removed (see Note 9).

7. After the slide air-drying in dark, apply 10 to 20 pL of DAPI counterstaining solution to the slide and cover the slide with a cover slip.

8. Male fetal cells were identified by the presence of two fluorescent signals of different colors (Fig. 1). The fetal and maternal cells showing representative signals were recorded using a Compulog IMAC-CCD S30 video camera module and analyzed using the in situ imaging system mounted on the fluorescence microscope.

9. Given the brightness of the signals, the slides are scanned at a magnification of x400, but every cell showing two signals of different colors are examined at x1000 magnification.

4. Notes

1. The order in which primers are used is important. We recommend using the X chromosome primer in the first reaction and the Y primers in the second reaction. Therefore, if the first labeling uses biotin-dUTP and second labeling uses digoxigenin-dUTP (bio-dig) for X and Y chromosome targets, respectively, an appropriate fluorochrome mix should be avidin-rhodamine/antidigoxigenin-fluorescein. Conversely, if the labeling order is dig-bio, the fluorochrome mix should be antidigoxigenin-rhodamine/avidin-fluorescein. The principle of selecting a relatively weak fluorochrome for the last PRINS target detection is critical for double-PRINS.

2. The lyophilized oligonucleotide is stable at -20°C for 1 yr or longer. It is generally accepted that oligonucleotides dissolved in TE are stable for at least 6 mo at -20°C or 4°C. Oligonucleotides dissolved in water are stable for at least 6 mo at -20°C. Do not store oligonucleotides in water at 4°C. TE is recommended when compared to deionized water because the pH of the water is often slightly acidic and can cause hydrolysis of the oligonucleotides.

3. For X chromosome detection, the PRINS program should be annealing at 65°C for 10 min, with an extension at 72°C for 10 min. For Y chromosome annealing, 56°C for 10 min and an extension to 72°C for 10 min is advised (4).

4. Blood specimens were processed at the latest, within 2 h of venepuncture. This is required to avoid fetal cell apoptosis as the result of their supposed fragility in maternal blood.

5. The efficiency of the PRINS procedure relies highly on the temperature and humidity conditions when preparing slides. The optimal conditions for dropping cells onto slides can be reached by using a Thermotron (CDS-5 [8]) or in a temperature/humidity-adjustable chamber. The optimal conditions may vary from laboratory to laboratory and should be determined by pretesting. Ideally, the nuclei on the slide should show a gray color, and no reflective nuclei or bright rings around any nuclei should be observed. High slide background noise could be caused by cellular debris generated during sample preparation. Therefore, you must wash the cell pellet with fresh fixative twice and repeat the slide dropping procedure. In addition, treat the slides with methacarn to make the DNA sample more accessible to the primers by the removal of loosely bound protein and discarded cytoplasmic debris.

6. The use of fresh prepared slides is recommended. Old slides may lead to reduced sensitivity and greater variability. Similarity, longer storage can give rise to background signals.

7. Use double primers for the same locus of chromosome Y to increase the efficiency of PRINS reaction.

8. No denaturation is required after the first PRINS reaction because the nucleic DNA remains denatured throughout the PRINS incubation.

9. Stringent washing in SSC obtains minimal background noise.

Acknowledgments

The authors are grateful to Dr Kieron Legge for review of the manuscript and to Mr. Marc Bronsard for his technical help. This study was supported by a grant from the Canadian Institute for Health Research and the Canadian Genetic Diseases Network (MRC/NSERC NCE Program) to Régen Drouin. Kada Krabchi was a recipient of a studentship from Valorisation Recherche Québec. Macoura Gadji is a student scholar of the Public Health Minister (MSP) and the National Center of Blood Transfusion (CNTS) of Senegal. Currently, he holds a studentship of the Foundation for Research into Children's Diseases. Régen Drouin holds the Canada Research Chair in Genetics, Mutagenesis and Cancer.

References

1. Koch J., Kolvraa S., and Bolund L. (1986) An improved method for labelling of DNA probes by nick translation. Nucleic Acids Res. 14, 7132.

2. Koch J., Gregersen N., Kolvraa S., and Bolund L. (1986) The use of biotinylated hybridization probes for routine analysis of unique sequences in human DNA. Nucleic Acids Res. 14, 7133.

3. Koch J. E., Kolvraa S., Petersen K. B., Gregersen N., and Bolund L. (1989) Oligo-nucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ. Chromosoma 98, 259-265.

4. Koch J., Hindkjaer J., Kolvraa S., and Bolund L. (1995) Construction of a panel of chromosome-specific oligonucleotide probes (PRINS-primers) useful for the identification of individual human chromosomes in situ. Cytogenet. Cell Genet. 71, 142-147.

5. Krabchi K., Lavoie J., Coullin P., Bronsard M., Pellestor F., Yan J., and Drouin R. (2004) From the conception of the PRINS to its coronation. Med. Sci. (Paris) 20, 465-473.

6. Yan J., Bronsard M., and Drouin R. (2001) Creating a new color by omission of 3 end blocking step for simultaneous detection of different chromosomes in multi-PRINS technique. Chromosoma 109, 565-570.

7. Krabchi K., Gros-Louis F., Yan J., Bronsard M., Masse J., Forest J. C., and Drouin R. (2001) Quantification of all fetal nucleated cells in maternal blood between the 18th and 22nd weeks of pregnancy using molecular cytogenetic techniques. Clin. Genet. 60, 145-150.

8. Spurbeck J. L., Zinsmeister A. R., Meyer K. J., and Jalal S. M. (1996) Dynamics of chromosome spreading. Am. J. Med. Genet. 61, 387-393.

9. Pellestor F., Girardet A., Lefort G., Andreo B., and Charlieu J. P. (1995) Selection of chromosome-specific primers and their use in simple and double PRINS techniques for rapid in situ identification of human chromosomes. Cytogenet. Cell Genet. 70, 138-142.

10. Speel E. J., Lawson D., Hopman A. H., and Gosden J. (1995) Multi-PRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum. Genet. 95, 29-33.

Was this article helpful?

0 0

Post a comment