PRINS Reactions

1. Primer stock solution: this solution is prepared by dissolving each primer (see Table 1 for the sequence) in TE buffer for a final concentration of 100 ||M (see Note 1).

Table 1

Primers That Have Been Used in Multi-PRINS Technique

Table 1

Primers That Have Been Used in Multi-PRINS Technique

Name

Location

Sequence

Annealing temperature

References

Alpha 7

7

GCTTGAAATCTCCACCTGAAATGCCACAGC

62.5°C

1

8c

8

CTATCAATAGAAATGTTCAGCACAGTT

62.5°C

3

18c

18

ATGTGTGTCCTCAACTAAAG

62.5°C

14

Xc

X

GTTCAGCTCTGTGAGTGAAA

65°C

14

D599

Y

TGGGCTGGAATGGAAAGGAATCGAAAC

56°C

2

D600

Y

TCCATTCGATTCCATTTTTTTCGAGAA

56°C

2

paired

with

D599

Tel. 1

Telomere

(TTAGGG)7

62.5°C

15

Tel. 2

Telomere

(CCCTAA)7

62.5°C

15

2. dNTP working solution: Dilute 1 |L each of 100 mM stock solution of dCTP, dGTP, and dATP (Roche Molecular Biochemicals) with 39 |L of sterile distilled water to a concentration of 2.5 mM. Dilute 100 mM stock solution of dTTP (Roche Molecular Biochemicals) to a concentration of 0.25 mMby mixing 1 |L of dTTP with 399 |L of sterile distilled water.

3. 1 mM of biotin-16-dUTP or biotin-11-dUTP (Enzo), and dig-11-dUTP (Roche Molecular Biochemicals).

4. Taq DNA polymerase (Roche Molecular Biochemicals).

5. 10X polymerase chain reaction (PCR) buffer (Roche Molecular Biochemicals).

6. 10X phosphate-buffered saline (PBS): 1360 mM NaCl, 20 mM KCl, 106 mM Na2HPO4, 15 mM KH2PO4, pH 7.2-7.4.

7. 1X PBS, pH 7.2-7.4 (diluted from stock 10X PBS). Store PBS solutions at ambient temperature and discard after 6 mo or sooner if the solution appears cloudy or contaminated.

8. Washing buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100, or 0.2% Tween-20.

9. Blocking buffer: Washing buffer with the addition of 5% skimmed milk powder.

10. Thermal cycling machine equipped with a flat block (PTC-100, MJ Research;

Was this article helpful?

0 0

Post a comment