Promoter switch

Sometimes the same gene can be expressed from different promoters. A realtime PCR assay can be designed to address this issue. Primer design is very restrictive under these circumstances as it is limited to the very 5' end of the RNA but, in principle, both TaqMan® and SYBR® Green assays can be used. An example of promoter switch concerns the PEG1/MEST gene causing biallelic expression in invasive breast cancer (Pedersen et al., 2002). Two alternative transcripts have been described for this gene. A SYBR® Green assay was useful to analyze the relative expression of each isoform in breast cancers. The analysis of promoter switch being based on sequences located in the very 5' of an mRNA an oligo-dT cDNA synthesis may not be recommended.

A* 24bp primer A

Allele A: AGTCGTACGTGTACGGTAGCTGACGTGACGTACGTGTACGTCCATTCAGTC Allele C: AGTCGTCCGTGTACGGTAGCTGACGTGACGTACGTTACGTCCATTGTCAGTC C*--------------------**------------ 3 6bp primer C

Figure 8.7A

primer A

Allele A: AGTCGTACGTGTACGGTAGCTGACGTGACGTACGTGTACGTCCATTCAGTC Allele C: AGTCGTCCGTGTACGGTAGCTGACGTGACGTACGTTACGTCCATTGTCAGTC C*--------------------**------------ 3 6bp primer C

Figure 8.7A

Joint use of size difference and melting curve analysis in allelic discrimination. The top figure shows the gel electrophoresis for genotyping by size allelic difference and the bottom figure shows the use of (negative derivative of) melting curve to distinguish the three genotypes in a diallelic locus.

Joint use of size difference and melting curve analysis in allelic discrimination. The top figure shows the gel electrophoresis for genotyping by size allelic difference and the bottom figure shows the use of (negative derivative of) melting curve to distinguish the three genotypes in a diallelic locus.

Was this article helpful?

0 0

Post a comment