Sample and standard preparation

Specimens and standards are prepared in the same manner, and should also include internal control nucleic acid (see Protocol 14.4). Standards must be diluted in the appropriate matrix, for example when urine samples are tested, 10-fold dilutions of the standard are prepared in negative urine. Briefly, 100 |jL of BKV standard at 1 x 108 copies per mL is added to 900 |L of negative urine. Subsequent dilutions are performed to provide seven standards ranging from 1 x 107 to 10 copies per mL of urine. Nucleic acids are extracted from 0.2 mL of each sample and standards using the Roche MagNAPure™ instrument (Roche Diagnostics, Australia).

BKV oligonucleotides (targeting the BKV T antigen gene; Hirsch et al., 2001) Forward primer AGCAGGCAAGGGTTCTATTAC TAAAT

Reverse primer GAAGCAACAGCAGATTCTCAACA Probe F AM -AAG ACCCTAAAG ACTTTCC

CTCTGATCTACACCAGTTT-TAMRA

Reaction mix (TaqMan® Universal PCR Master

Mix; Applied Biosystems, Australia)

TaqMan® Universal PCR Master Mix 12.5 |L

RNase-free water 5.3 |L Specimen or control nucleic acid extract 5.0 |L

Cycling conditions (ABI Prism® 7500; Applied Biosystems, United States) Activation/denaturation 1 cycle:

95°C 10 min Cycling 5 cycles: 95°C 15 sec 60°C 60 sec acquisition

Result interpretation: The BKV concentration in each specimen is deter mined using a standard curve. Standard curves are generated from the range of controls included in the assay protocol, by software provided with the instrument (ABI 7500 system V.1.2.3f2). Values are expressed in copies per mL of specimen. Results are interpreted subject to the internal control results (see Protocol 14.4).

Was this article helpful?

0 0

Post a comment