Sample preparation

The concentration of seal herpesvirus (PhHV-1) added to each patient specimen should be sufficient to provide an average Ct value of approximately cycle 30 in a correctly extracted sample containing no PCR inhibitors. This equates to a final concentration of approximately 5,000 copies per mL of specimen. Briefly, 10pL of PhHV-1 at 500 copies per pL should be added to 1mL of each specimen.

PhHV-1 oligonucleotides Forward primer GGGCGAATCACAGATTGAATC Reverse primer GCGGTTCCAAACGTACCAA Probe TTTTTATGTGTCCGCCACCAT

CTGGATC

The reaction mix, fluorophores and cycling conditions used for the PhHV-1 assay can readily be adapted to those utilized by the testing laboratory. Conditions must be standardized so that the assay achieves a Ct value of approximately cycle 30, with minimal inter-assay and intra-assay variability, for a correctly extracted sample containing no PCR inhibitors.

Result interpretation: Specimens providing Ct values exceeding two standard deviations from the expected Ct value are considered to be unsuitable. They may contain PCR inhibitors, have been inefficiently extracted, or have been subject to other conditions that have compromised the PCR. These specimens should be repeated.

Specimens providing Ct values within two standard deviations from the expected Ct value can be used in the calculation of viral load of the target test virus using a standard curve.

Troubleshooting guide 14.1: False-negative result in the WhSl-para3-5N assay

The specimen that was not detected in the WhSl-para3-5N assay was investigated further to identify the cause of the assay failure. Following thermocycling, the WhSl-para3-5N PCR reaction mix for this specimen was examined by gel electrophoresis and a PCR amplification product of the expected size (105 base pairs) was observed (see Figure 14.1). This demonstrates that amplification had occurred and suggests that the

Figure 14.1

Gel electrophoresis image of the reaction mix from the specimen providing a false-negative result in the WhSl-para3-5N assay. A 105 base pair product was observed for the specimen (run in duplicate in lanes 6 and 7) and positive controls (lanes 2 and 3) but not in the negative controls (lanes 4 and 5). A 200 base pair ladder was included in lane 1.

Figure 14.1

Gel electrophoresis image of the reaction mix from the specimen providing a false-negative result in the WhSl-para3-5N assay. A 105 base pair product was observed for the specimen (run in duplicate in lanes 6 and 7) and positive controls (lanes 2 and 3) but not in the negative controls (lanes 4 and 5). A 200 base pair ladder was included in lane 1.

source of the failure was not in amplification but in the detection of the amplification product. The PCR product from this specimen was then sequenced to identify the oligonucleotide target sequences in this parainfluenza type 3 strain.

The fact that an amplification product was produced indicated that both primers hybridized to the target, therefore, mismatches between the probe and its target appeared to be the likely source of the problem. Thus, the same primers that were used in the WhSl-para3-5N assay could be used for the DNA sequencing reaction. On the other hand, had a PCR product not been obtained, then mismatches between the primers and their targets would be the more probable explanation. Thus, a second primer pair, external to those utilized by the assay would need to be designed and employed to sequence the primer targets. Nevertheless, for this investigation a second external primer was used to illustrate the process.

Briefly, the two external primers (forward ACCAGGAAACTATGCTGCAGAACGGC and reverse CCATACCTGATTGTATTGAAGAATGAAGC) were used in a standard RT-PCR reaction to amplify a 409 base pair sequence from the above specimen. The amplification products were separated by electrophoresis through a 1% agarose gel. The specific band (409 bp) was excised and purified using a QIAquick gel extraction kit (Qiagen, Germany). DNA sequencing was performed using the above forward primer in an ABI Prism Dye Terminator Cycle Sequencing kit (Applied Biosystems, USA) and was analyzed on an ABI 377 DNA sequencer (Applied Biosystems, USA). The sequence obtained from this specimen was then compared to the primer and probe sequences used in the WhSl-para3-5N assay.

Interestingly, the sequencing results showed that mismatches (bold underlined) were present with all three oligonucleotides. For both primers, there were mismatches towards the 5' end. It should be noted that the length and Tm of primers typically used in standard TaqMan® cycling conditions will usually allow them to accommodate one or two 5' mismatches with little impact on the PCR. This is consistent with the results observed here, where amplification product was present for this specimen. However, in this parainfluenza type 3 strain there were four mismatches within the binding site of the WhSl-para3-5N TaqMan™ probe. This many mismatches most likely prevented the probe from adequately hybridizing to the target and therefore caused the detection failure.

F Primer Specimen

R Primer

Specimen

CGGTGACACAGTGGATCAGATT TGGTGACACAGTGGATCAGATT

AGGTCATTTCTGCTAGTATTCATTGT TATT

AG ATCATTCCTGCTAGTATTCATTGT TATT

Probe TCAATCATGCGGTCTCAACAGAGC TTG

Specimen TCAATTATGCGATCCCAACAGAGC TTA

Troubleshooting guide 14.2: Variation in fluorescent signal from positive specimens in the RSV MGB assay

Three RSV-positive specimens providing representative fluorescent signals (see Figure 14.2) were investigated further to identify the cause of the variation in fluorescent response. Briefly, the PCR products from these specimens were

Cycle number

Figure 14.2

Cycle number

Figure 14.2

Fluorescent signal for three representative positive specimens in the RSV MGB probe assay.

sequenced and probe targets compared to the RSV MGB TaqMan® probe sequence. For this investigation, the same primers used in the respiratory syncytial virus assay were used to sequence the forward and reverse DNA strains of the PCR products.

The sequencing results showed that specimen 1, which provided optimal fluorescence, had no mismatches with the RSV MGB probe. In contrast, specimens 2 and 3, which provided lower fluorescent signal, each had a single mismatch (bold underlined) with the probe. The mismatched bases in each of these specimens were at different positions on the probe and resulted in varying fluorescent signals.

RSV MGB probe TCAATACCAGCTTATAGAAC Specimen 1 TCAATACCAGCTTATAGAAC Specimen 2 TCTATACCAGCTTATAGAAC Specimen 3 TCAATACCAGCTTACAGAAC

T3 I

0.080.07 0.06 0.05 0.040.03 0.02 0.01 -0.00 -0.01 --0.02 -0.03

HSV type 2 HSV type 2

specimen A specimen B

HSV type 2 positive control

HSV type 2 HSV type 2

specimen A specimen B

HSV type 2 positive control

44.0 46.0 48.0 50.0 52.0 54.0 56.0 58.0 60.0 62.0 64.0 66.0 68.0 70.0 72.0 74.0 76.0 78.0 80.0 82.0 84.0 86.0 88.0 90.0 92.0

Temperature (°C)

Figure 14.3

LightCycler® melting curve analysis for two herpes simplex virus type 2 positive specimens showing uncharacteristic melting temperatures compared to a herpes simplex virus type 2 positive control. The results were obtained using a hybridization probe-based assay targeting the DNA polymerase gene.

Troubleshooting guide 14.3: Uncharacteristic herpes simplex virus type 2 melting curves

Two herpes simplex virus (HSV) type 2 positive specimens providing uncharacteristic melting curves were further investigated to identify the cause of the shift in melting temperature. Briefly, PCR products from these specimens were sequenced and the probe target sequence was compared to the Espy hybridization probe sequences, which should be fully complementary to HSV type 2 DNA. For this investigation, it was unnecessary to design primers outside the Espy primer targets, as the probe target sequences were of primary interest. Thus, the primers utilized in the Espy HSV assay (Protocol 16.2) were used to sequence the PCR products in forward and reverse direction.

The sequencing results showed that both of the HSV type 2 positive specimens had mismatches with the Espy hybridization probes. For specimen A there were three mismatches (bold-underlined) compared to the Espy probe 2 sequence and for specimen B there were two mismatches (bold-underlined) compared to the Espy probe 1 sequence.

Probe 1

GTACATCGGCGTCATCTGCGGGGGCAAG

Strain A

GTACATCGGCGTCATCTGCGGGGGCAAG

Strain B

GTACATCGGCGTTAITIGCGGGGGCAAG

Probe 2

TGCTCATCAAGGGCGTGGATCTGGTGC

Strain A

TGCTCATTAAGGGCGTCGACCTGGTGC

Strain B

TGCTCATCAAGGGCGTGGATCTGGTGC

Troubleshooting guide 14.4: Underestimation of BK viral load due to sequence variation

The specimen providing discrepant BKV viral load results between the BK-qLC and BKV-Tag-qPCR assays was further investigated. Briefly, the DNA segment of the VP2 gene targeted by the BK-qLC PCR assay was sequenced using primers external to those used in the assay. The sequence was then compared to the primer and probe sequences used in the BK-qLC assay.

The results showed a single base mismatch (bold-underlined) with the forward primer was responsible for the change in amplification characteristics in the BK-qLC assay. It should be noted that the annealing temperature used in the BK-qLC assay was 55°C whereas the Tm of this primer (calculated using Primer Premier version 5; Premier Biosoft International, CA, USA) was only 51.8°C assuming no mismatches and 47.6°C if the 3' cytosine base was excluded. Thus, the low Tm of this primer was likely to have compounded the effects of sequence mismatch.

Forward primer Specimen

GTAAAAGACTCTGTAAAAGACTCC GTAAAAGACTCTGTAAAAGACTCG

0 0

Post a comment