Sample preparation

Swab specimens are placed in 1 mL of sterile saline and vortexed. Nucleic acids are extracted from 0.2 mL of each suspension using the Roche MagNAPure™ instrument (Roche Diagnostics, Australia).

HSV oligonucleotides (targeting the HSV DNA polymerase gene; Espy et al., 2000). Forward GCTCGAGTGCGAAAAAACGTTC Reverse CGGGGCGCTCGGCTAAC Probe 1 GTACATCGGCGTCATCTGCGGGGGC

AAG-fluorescein Probe 2 LC-Red640-TGCTCATCAAGGGCGTG GATCTGGTGC-Phosphate

Reaction mix (LightCycler® FastStart DNA Master Hybridization Probes kit; Roche Diagnostics,

Australia)

Roche kit Master reagent (10 x) 2.0 pL

Forward primer (10 pM) 0.4 pL

Reverse primer (10 pM) 0.8 pL

RNase-free water 9.0 pL Specimen or control nucleic acid extract 5.0 pL

Total 20.0 pL

Result interpretation

Cycling conditions (LightCycler®; Roche Diagnostics, Australia) Activation/denaturation 1 cycle:

95°C 10 min Cycling 55 cycles: 95°C 10 sec

55°C 10 sec single acquisition 72°C 20 sec Melting curve analysis 1 cycle: 95°C 5 sec 40°C 5 sec

95°C 5 sec continuous acquisition (ramp at 0.2°C/sec)

Specimens providing a melting temperature of 67°C are considered positive for HSV type 1 DNA whereas specimens providing a melting temperature of 74°C are considered positive for HSV type 2 DNA.

Protocol 14.3: Quantitative analysis of BKV load by a 5' nuclease real-time PCR (BKV-Tag-qPCR) assay

Was this article helpful?

0 0

Post a comment