Sequence polymorphism and fluorescent response

The impact of sequence variation upon real-time PCR assays is not simply restricted to producing false-negative results, but can have more subtle effects, including the reduction of the overall fluorescent signal produced in an assay. Recently, we developed a real-time PCR for the detection of respiratory syncytial virus (RSV) using a 3' minor groove binder (MGB) TaqMan® probe. These MGB probes are particularly suited for the detection of single nucleotide polymorphisms (Kutyavin et al., 2000). However, they are also quite useful where only limited target sequence is available, given their shorter length compared to standard DNA TaqMan® probes. It is for the latter reason that we designed a MGB probe or the detection of respiratory syncytial virus sequences. This RSV MGB assay used RSV L-gene sequences available on the Genbank public database. Based on these sequences, two primers (forward AGTAGACCATGTGAATTCCCTGC; reverse GTCGATATCTTCATCACCATACTTTTCTGTTA) and one MGB probe (FAM-TCAATACCAGCTTATAGAAC-MGB-BHQ1) were designed.

During the initial evaluation of the assay, significant differences were observed between the linear amplification curves produced by positive specimens. In particular, the fluorescent signal for some positive specimens deviated only slightly from the baseline fluorescence (see Figure 14.2). Sequence analysis of the amplification products from several of these positives samples showing varying fluorescent signal revealed that mismatches with the MGB probe were responsible for the differences in fluorescence (see Troubleshooting guide 14.2). Briefly, no mismatches between the target and MGB probe gave an optimal fluorescent signal, whereas a single mismatch significantly lowered the fluorescent signal, the extent of which was dependent on where the mismatch occurred. Notably, specimens providing the lowest fluorecent signal had a mismatch nearer the 3' end of the MGB probe (Whiley and Sloots, 2006.)

These results highlight the usefulness of MGB TaqMan® probes for the detection of mismatches. However, they suggest that MGB TaqMan® probes may have limited utility for viral diagnostics, particularly where the probes are used to screen for uncharacterized viral strains. It should be noted that we have been using standard DNA TaqMan® probes for many of our respiratory virus assays and have not observed similar differences in fluorescent signal. As a result, our laboratory now preferentially adopts standard DNA TaqMan® probes, rather than MGB TaqMan® probes, for routine viral screening.

0 0

Post a comment